Bi-Monthly Journal
This is a bi-monthly updated blog tracking Chase's progress throughout the completion of his project.
IntroThe month of March was a very crazy month for me. I had a jam packed spring break, tons of work for school, and continued to get college decisions back every few days. However, this crazy schedule did not stop me from making progress on my fellows project! The main highlights are the work I did to my SOP, my major success in finding a vector DNA that will work for the E.Coli bacteria I am using, some work in my lab setup, and minor update to the website. Each of these major strides in the project will be detailed below. Major SOP UpdateDuring the first half of March, I focused primarily on updating my SOP. I have done tons of work to my SOP in the past few months, flushing out what is important and what is just my notes. However, this document was always meant to be a "living" document, that is, something that I am always working on. So, I decided to further refine the SOP. Now, the SOP has literal step-by-step tasks listed in order, not only with the general ideas like before, but actual specifics. As you can see in the word doc below, there are literal measurements in mL, g, etc for many of the steps. My goal was (and still is) to make the SOP so specific and detailed that literally anyone who knows how to read can carry out the same experiments I am attempting to do. This process of hyper-editing the SOP forces me to question each step and ensure I 1) know what I have to do in the lab, and 2) minimize my time spent "looking for the next step." As I continue to carry out actual in-lab steps, I will continue to refine the SOP and take notes on what I did, what worked, what didn't, etc. This will ensure that the end product come May is very comprehensive. Below is a copy of the SOP: Compatible Plasmid DNA Vector!!During spring break, I was extremely busy. I met with Mr. Witzel and Mr. DeMarte to outline my spring break goals before break, however because I would be out of state for most of spring break (touring colleges, as seniors do), going to sailing practice the second week of break, and because of the fact that the school was closed to students, I could not start in-lab steps like I wanted. I could have potentially began some bacterial growth before break; however, I did not want to waste materials, so it made more sense to wait until after break to begin in-lab steps. Because of this, I had 2 weeks to do everything that was not an in-lab step. I mainly used this time to focus on finding the perfect Plasmid DNA Vector. Essentially, a plasmid DNA vector is a piece of DNA that tells a cell, in this case, the E.Coli bacteria cells I will be growing, what to do. I had to look for a specific vector that not only would work in E.Coli, but also had specific extra pieces of DNA attached. Essentially, I was looking for a "base" plasmid, to which I would make "cuts" in it and attach new pieces of DNA, pieces of DNA I also had to find. And then, I had to find a way to order all of these pieces of DNA, essentially turning a bunch of As, Ts, Cs, and Gs into physical vials of slime (DNA). After weeks of searching, I have settled on a plasmid called pDLIII13e that has some specific characteristics. First, it will have two multi-cloning sites, where the plasmid will be cut and new DNA strands will be put in. These are at the Hind-III and BamHl sites. To each site, a specific piece of DNA will be added. For the Hind-III "cut site," the DNA for the Alpha-subunit of Hemoglobin (DNA that is basically code for a "chunk" of the final hemoglobin protein we want to synthesize) will be added. And at the BamHl cut site, DNA will be added for the Beta-subunit of Hemoglobin (essentially the sister subunit to the alpha-subunit). Both of these subunits are needed in order to produce a full hemoglobin protein, which has two of both. By putting the DNA sequence into the vector for each of these, we are essentially giving the bacteria the instructions to make the proteins we want- almost like giving a computer code. The DNA sequences for both the Alpha and Beta Subunits are below: Beta Subunit: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA Alpha Subunit: ACTCTTCTGG TCCCCACAGA CTCAGAGAGA ACCCACCATG GTGCTGTCTC CTGCCGACAA GACCAACGTC AAGGCCGCCT GGGGTAAGGT CGGCGCGCAC GCTGGCGAGT ATGGTGCGGA GGCCCTGGAG AGGATGTTCC TGTCCTTCCC CACCACCAAG ACCTACTTCC CGCACTTCGA CCTGAGCCAC GGCTCTGCCC AGGTTAAGGG CCACGGCAAG AAGGTGGCCG ACGCGCTGAC CAACGCCGTG GCGCACGTGG ACGACATGCC CAACGCGCTG TCCGCCCTGA GCGACCTGCA CGCGCACAAG CTTCGGGTGG ACCCGGTCAA CTTCAAGCTC CTAAGCCACT GCCTGCTGGT GACCCTGGCC GCCCACCTCC CCGCCGAGTT CACCCCTGCG GTGCACGCCT CCCTGGACAA GTTCCTGGCT TCTGTGAGCA CCGTGCTGAC CTCCAAATAC CGTTAAGCTG GAGCCTCGGT GGCCATGCTT CTTGCCCCTT GGGCCTCCCC CCAGCCCCTC CTCCCCTTCC TGCACCCGTA CCCCCGTGGT CTTTGAATAA AGTCTGAGTG GGCGGCAAAA AAAAAAAAAA AAAAAAAAAA AACAAAAAAA AAAAAAAAAA AAAAAAAAAA AAA Additionally, the plasmid DNA vector has a special drug resistance to the antibiotic tetracycline. This allows me to grow the bacteria carrying this vector on petri-dishes containing growing media (bacteria food) with an antibiotic, without the bacteria dying. However, the antibiotic will kill all the other types of bacteria from the air that we don't want, that try to grow there. There are a few websites where I can actually purchase the DNA sequences and Plasmid I need, so when the time comes (very soon), I will be able to purchase them direct. Further Lab SetupI have also done a decent amount of Lab setup work. Primarily, I programmed my PCR Machine. Essentially, I spent a few hours programming exactly what temperatures I need to grow the DNA I insert at, and for how long. I will try to upload a picture soon, but basically the finished program looks like a 2-dimensional hill, with the peaks being the high temperatures and the valleys being the low temperatures. The actual temperature of the inside of the PCR machine will run along this hill. Website MaintenanceAs you can see from the home page, I did some minor cosmetic and content updates to my website. These are not major because I have been devoting most of my time to the work of the project itself. However, I am still trying to make my project website cleaner and overall more inviting. Here is a screenshot of some of the updates I made: Looking ForwardOver the next few weeks, I will be doing two main things. First, applying for a second round of funding, to purchase more materials. And second, growing the first batches of bacteria. More to come soon, so stay tuned!
0 Comments
Summary of WorkSince the middle of February, I have made a good amount of progress on my fellows progress. I mainly focused these past few days on going through the comments from my Mid Year Review presentation, and evaluating their suggestions, etc. I did not receive many suggestions, mainly short "good jobs" and that sort of thing, however one suggestion was to address the relation of my project with COVID-19. So, I have since worked on my mid-year presentation a bit, adding some slides that describe the global blood shortages during the pandemic and how this project can hope to address them. This will be useful later on, when I have to make my final presentation. Looking ForwardOver the next 15 days, I hope to really get in depth with my in-lab research. Because spring sports have started back up and I have been traveling a ton these past few days, It has been difficult to find consistent time to dedicate towards the actual research of the project. I hope to begin growing a few E. coli cultures in the coming days.
|