Bi-Monthly Journal
This is a bi-monthly updated blog tracking Chase's progress throughout the completion of his project.
Fellows Final PresentationAfter over a year of work, my project culminated in a final presentation to the friends and families of the fellows program, plus the Eney family, who made this program possible. A special thank you to Mr. DeMarte and Mr. Witzel for helping me through this process, and the Severn finance department for working with me so many times this spring. Final note...A quick piece of advice for next year's fellows. You are some of the brightest students at Severn, and I know you are all looking forward to doing your projects. The best way to see it through to the end and achieve what you hope to achieve is to stay excited about your project. Make it fun for yourself, and don't see it as work but as a chance to genuinely explore one of you passions. If you are doing your project only for a boost to your college applications, or for the bragging rights of being in the fellows program, you won't be as successful with your projects as your peers who are genuinely invested for the right reasons. Keep that in mind in the coming months. Good luck, and if you ever need help or advice, you know how to reach me.
0 Comments
Overall ProgressSince my last post, I have made one of the greatest strides in work for my fellows project. I have ramped up the in-lab work to be virtually 5 days a week (the maximum severn is open), and I have achieved a ton of milestones as outlined in the SOP. Outside of the work for the project itself, I have done tons of work regarding the fellows program requirements. This includes planning for the Fellows Fair coming up, as well as creating a final summative video that talks about the project. And, I heavily updated the website, making it easier to navigate, cleaner, and finally finished. All of the different types of progress I have made, both related to the project and to the fellows program, are described below. Growing Generations of E.ColiOriginally, I got my first growth from the transformation of the plasmid pUC18 into competent JM109 E.Coli cells. This allowed growth on normal LB agar plates. However, since that first growth, many generations have been repeatedly grown. Each growth cycle, a single strong colony is selected and replated to be regrown. This allows for one single strain/colony to be our net result, so now, almost a month later, the e.coli cultures are highly refined. These cultures will be turned into competent cells to be used in the procedures discussed below. Second Major Round of PurchasingOne of the bigger milestones for the project in general that I passed was going through a second round of funding to make purchases. This round of funding was used to purchase the necessary Plasmids, DNA, and chemicals to carry out the bacterial transformations necessary. Below is a copy of the purchase sheet. Formal Write-up, Name, Planning for fairSince the fellows fair is taking place this Friday, I had to do some logistics/planning. One of the main tasks was determining an official name and short description of the project. I settled on Bacteria2Blood, as that has been the unofficial title for the project for a few months. Here is the official short description: Inspired by the global blood shortages onset by COVID-19, this 3-phase project seeks to research the creation of synthetic blood in the lab. Consisting of a 4100+ word Scientific Literature Review submitted for publication, the development of a Standard of Practice detailing necessary in-lab steps, and actual scientific research via the creation of an in-school laboratory, this project exemplifies the capabilities of modern genetic engineering; cutting out the middleman in an effort to make life saving blood accessible to all. I think this write up does a good job of capturing the big picture of the project. In lab workArguably the largest portion of work I have completed since mid-april has been the in lab research. Spanning multiple hours each day, I am carrying out experiments ranging from growing colonies of E. coli to transforming DNA into bacteria. The majority of media I have are Timelapse's of my work, which cannot be uploaded onto a weebly, however I am looking into compiling them into one video and uploading it to YouTube so that I may post it on my blog. Highly Detailed sub-SOP (Bacterial Transformation)I wrote a very detailed step by step SOP specifically for the bacterial transformations I need to do. While it may seem relatively simple, writing these procedures took multiple hours of research to ensure the chemistry backing each of the steps would result in the desired effects. Website UpdateI also spent a ton of time updating my website. I have included a collection of examples below, however you should feel free to navigate around the website and see the new pages for yourself. Some highlights are a deliverables page and a contact us page. Final VideoFinally, I spent multiple hours creating an 8 minute long video summarizing the work I have done on my fellows project. It was edited and recorded to look as professional as possible, and can be seen at this link:
Summary of ProgressSince the end of March, I have made some significant progress on my fellows project. In addition to further refining the SOP (which at this point it should be obvious that I will likely update it to some degree pretty regularly until the end of the project), I also have done some in-lab experiments. Mainly, I focused on growing the original bacteria I ordered a few weeks ago. I am trying to test if the bacteria is still viable, in order to determine if I need to order more. Additionally, I am making sure it can be made back into "competent" bacteria, or cells that can take in the plasmids I need them to. There is a specific process to make an E. coli cell competent (which I have researched, discussed with Mr. Witzel, and added to the SOP) but I need to make sure this batch of bacteria can handle that process before I proceed. I have also begun to take very detailed notes of every thing I do in the lab. I currently have been typing them, however Mr. DeMarte and I discussed getting a physical written notebook instead, as that is the most common way researchers take their notes when doing lab work. More on that soon. Videos + Pictures of Lab WorkIntroThe month of March was a very crazy month for me. I had a jam packed spring break, tons of work for school, and continued to get college decisions back every few days. However, this crazy schedule did not stop me from making progress on my fellows project! The main highlights are the work I did to my SOP, my major success in finding a vector DNA that will work for the E.Coli bacteria I am using, some work in my lab setup, and minor update to the website. Each of these major strides in the project will be detailed below. Major SOP UpdateDuring the first half of March, I focused primarily on updating my SOP. I have done tons of work to my SOP in the past few months, flushing out what is important and what is just my notes. However, this document was always meant to be a "living" document, that is, something that I am always working on. So, I decided to further refine the SOP. Now, the SOP has literal step-by-step tasks listed in order, not only with the general ideas like before, but actual specifics. As you can see in the word doc below, there are literal measurements in mL, g, etc for many of the steps. My goal was (and still is) to make the SOP so specific and detailed that literally anyone who knows how to read can carry out the same experiments I am attempting to do. This process of hyper-editing the SOP forces me to question each step and ensure I 1) know what I have to do in the lab, and 2) minimize my time spent "looking for the next step." As I continue to carry out actual in-lab steps, I will continue to refine the SOP and take notes on what I did, what worked, what didn't, etc. This will ensure that the end product come May is very comprehensive. Below is a copy of the SOP: Compatible Plasmid DNA Vector!!During spring break, I was extremely busy. I met with Mr. Witzel and Mr. DeMarte to outline my spring break goals before break, however because I would be out of state for most of spring break (touring colleges, as seniors do), going to sailing practice the second week of break, and because of the fact that the school was closed to students, I could not start in-lab steps like I wanted. I could have potentially began some bacterial growth before break; however, I did not want to waste materials, so it made more sense to wait until after break to begin in-lab steps. Because of this, I had 2 weeks to do everything that was not an in-lab step. I mainly used this time to focus on finding the perfect Plasmid DNA Vector. Essentially, a plasmid DNA vector is a piece of DNA that tells a cell, in this case, the E.Coli bacteria cells I will be growing, what to do. I had to look for a specific vector that not only would work in E.Coli, but also had specific extra pieces of DNA attached. Essentially, I was looking for a "base" plasmid, to which I would make "cuts" in it and attach new pieces of DNA, pieces of DNA I also had to find. And then, I had to find a way to order all of these pieces of DNA, essentially turning a bunch of As, Ts, Cs, and Gs into physical vials of slime (DNA). After weeks of searching, I have settled on a plasmid called pDLIII13e that has some specific characteristics. First, it will have two multi-cloning sites, where the plasmid will be cut and new DNA strands will be put in. These are at the Hind-III and BamHl sites. To each site, a specific piece of DNA will be added. For the Hind-III "cut site," the DNA for the Alpha-subunit of Hemoglobin (DNA that is basically code for a "chunk" of the final hemoglobin protein we want to synthesize) will be added. And at the BamHl cut site, DNA will be added for the Beta-subunit of Hemoglobin (essentially the sister subunit to the alpha-subunit). Both of these subunits are needed in order to produce a full hemoglobin protein, which has two of both. By putting the DNA sequence into the vector for each of these, we are essentially giving the bacteria the instructions to make the proteins we want- almost like giving a computer code. The DNA sequences for both the Alpha and Beta Subunits are below: Beta Subunit: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA Alpha Subunit: ACTCTTCTGG TCCCCACAGA CTCAGAGAGA ACCCACCATG GTGCTGTCTC CTGCCGACAA GACCAACGTC AAGGCCGCCT GGGGTAAGGT CGGCGCGCAC GCTGGCGAGT ATGGTGCGGA GGCCCTGGAG AGGATGTTCC TGTCCTTCCC CACCACCAAG ACCTACTTCC CGCACTTCGA CCTGAGCCAC GGCTCTGCCC AGGTTAAGGG CCACGGCAAG AAGGTGGCCG ACGCGCTGAC CAACGCCGTG GCGCACGTGG ACGACATGCC CAACGCGCTG TCCGCCCTGA GCGACCTGCA CGCGCACAAG CTTCGGGTGG ACCCGGTCAA CTTCAAGCTC CTAAGCCACT GCCTGCTGGT GACCCTGGCC GCCCACCTCC CCGCCGAGTT CACCCCTGCG GTGCACGCCT CCCTGGACAA GTTCCTGGCT TCTGTGAGCA CCGTGCTGAC CTCCAAATAC CGTTAAGCTG GAGCCTCGGT GGCCATGCTT CTTGCCCCTT GGGCCTCCCC CCAGCCCCTC CTCCCCTTCC TGCACCCGTA CCCCCGTGGT CTTTGAATAA AGTCTGAGTG GGCGGCAAAA AAAAAAAAAA AAAAAAAAAA AACAAAAAAA AAAAAAAAAA AAAAAAAAAA AAA Additionally, the plasmid DNA vector has a special drug resistance to the antibiotic tetracycline. This allows me to grow the bacteria carrying this vector on petri-dishes containing growing media (bacteria food) with an antibiotic, without the bacteria dying. However, the antibiotic will kill all the other types of bacteria from the air that we don't want, that try to grow there. There are a few websites where I can actually purchase the DNA sequences and Plasmid I need, so when the time comes (very soon), I will be able to purchase them direct. Further Lab SetupI have also done a decent amount of Lab setup work. Primarily, I programmed my PCR Machine. Essentially, I spent a few hours programming exactly what temperatures I need to grow the DNA I insert at, and for how long. I will try to upload a picture soon, but basically the finished program looks like a 2-dimensional hill, with the peaks being the high temperatures and the valleys being the low temperatures. The actual temperature of the inside of the PCR machine will run along this hill. Website MaintenanceAs you can see from the home page, I did some minor cosmetic and content updates to my website. These are not major because I have been devoting most of my time to the work of the project itself. However, I am still trying to make my project website cleaner and overall more inviting. Here is a screenshot of some of the updates I made: Looking ForwardOver the next few weeks, I will be doing two main things. First, applying for a second round of funding, to purchase more materials. And second, growing the first batches of bacteria. More to come soon, so stay tuned!
Summary of WorkSince the middle of February, I have made a good amount of progress on my fellows progress. I mainly focused these past few days on going through the comments from my Mid Year Review presentation, and evaluating their suggestions, etc. I did not receive many suggestions, mainly short "good jobs" and that sort of thing, however one suggestion was to address the relation of my project with COVID-19. So, I have since worked on my mid-year presentation a bit, adding some slides that describe the global blood shortages during the pandemic and how this project can hope to address them. This will be useful later on, when I have to make my final presentation. Looking ForwardOver the next 15 days, I hope to really get in depth with my in-lab research. Because spring sports have started back up and I have been traveling a ton these past few days, It has been difficult to find consistent time to dedicate towards the actual research of the project. I hope to begin growing a few E. coli cultures in the coming days.
Summary of WorkSince the end of January, I have made a ton of progress on my fellows project. On the Admin side, I completed my Fellows Mid-Year Review Presentation! For those not familiar, this was a presentation to a panel of about 9 Severn Faculty (some related to the project, some related to the fellows program, and others completely unfamiliar with both). The presentation covered the three complete phases of my project thus far, as well as my project outlook for phase 4. A copy of the presentation can be seen below. I also finished setting up the lab in the chemical storage room between Mr. DeMarte's room and Mr. Witzel's room. This space will serve as my base of operations for all things fellows through the end of the year. As part of the lab setup, I created a system with Mr. DeMarte and Mr. Witzel of coordinating when I am working in the lab, including a synced google calendar, and a white board writing system. Photos of the lab during setup are pictured below. Mid-year Fellows PresentationLab Setup PhotosHere are some brief photos of my lab setup! Since these pictures, the lab has been stocked with many more chemicals, machines, etc.
SummaryOver the course of January, I did a lot of admin-related stuff for my project. I met with my mentors (Mr. DeMarte and Mr. Witzel) multiple times, discussing my plan moving forward. Mr. DeMarte and I made a plan for cleaning the chemical storage room, so I can use that room for the fellows project. We invited the entire senior class to sign up to help, which will help give seniors service hours and will get the room cleaner, quicker. Plan Looking ForwardLooking forward, the plan for February is to have my lab space entirely cleaned up and set up by my February 11th Fellows Mid-Year presentation. Assuming I am allowed to continue with the fellows program, I will begin actual, in lab research after 2/11.
Summary of WorkDuring the second half of December, I have worked on some general planning parts of the project as prep for the in-lab portion of the project. I have been working on designing a bioreactor that should work, as per the specifications of my SOP. However, I still need to do more research before I finalize the design and buy parts. I also have finalized the gene vector sequence, which is detailed below. This vector will allow for me to make the E. coli produce the proteins I want. Gene Vector SequenceBelow is the rHb0.0 Vector that will work best for the project. Looking ForwardLooking forward, I need to finalize the bioreactor design, and order the gene vector. I am hoping to do both of these before the end of January.
Summary of WorkThe past 15 days have been extremely packed with fellows-related stuff for me! I finished the SOP and created a final, edited version, which is below. This version will essentially be my guide for the in-lab research after winter break, and is extremely comprehensive and specific. It was the culmination of 2 months of work and combined tons of papers into one cohesive, technical step-by-step. In addition to completely finishing and editing a final draft of the SOP, I also created an itemized list for every single item I will need for my project's in-lab portion. The list includes everything from chemicals to E. coli bacteria to thousands of dollars in technical scientific machines, however I made an effort to be as cost-conscious as possible while creating the list. I compared numerous suppliers on every single item to ensure I was finding the cheapest, most cost-effective solution to every step of the SOP. I made sure to list enough materials to do the necessary trials, without overspending on too much extra (leaving me a margin for error which is inevitable, without breaking the bank). This list took days to create because every single item was researched, and is extremely comprehensive. There are only 3 items on the list that are not yet determined: the rHb0.0 DNA plasmid, the complimentary oligonucleotides, and the Bioreactor. (see "Looking forward" below for my plan with these three items). Some of the items have been ordered using the school credit card. However, because of the large amount of spending in such a short period of time, the card began to decline any more purchases (something about "suspected fraud..." oops). So, I spent about 2 hours with Ms Carsley on 12/15 making filled requisition forms with pictures and specifications for every. single. item. (sans the ones already ordered). This was tedious (and thank you Ms. Carsley for the helping complete them) but it was very rewarding in the end to have such a large milestone completed. The materials should be ordered within the coming days, and arrive after break. I also met with Mr. DeMarte briefly and updated him on everything I have been doing and plan to do over break (see "Looking Forward" below). This meeting was short and to the point, but it was good to just touch base and keep my mentors updated. Finalized SOPItemized Purchasing ListPICTURES!!!!! :)Finally, something other than just words on one of my blog posts! I envy my artistic & creative Fellows peers who have visually interesting blog posts... Here are some shots from when I was ordering materials with Ms. Carsley on 12/15. Shout out to the finance department at Severn for helping when the credit card declined! Looking ForwardI mentioned above that there were a few things I did not order in this main round of ordering. The rHb0.0 DNA plasmid and the complimentary oligonucleotides are both things I can order AFTER winter break, when I have the "lab" set up. This will be important to do then as opposed to now because both the DNA and the oligonucleotides have a shelf life. I am also planning to do a ton of research over break, determining which companies I can get to synthesize the plasmids and oligonucleotides for me for the cheapest price. The third item I have not yet purchased is the bioreactor. This is the machine that will allow the DNA-filled bacteria to actually product the proteins I want them to, and they typically range in the 10's of thousands of dollars. Obviously that is not feasible for the scope of this project, so I am planning to design my own over break! Once I have the design finalized, I will meet with my mentors, show it to them, and then order the necessary parts.
January will be spent organizing all the materials as they come in, cleaning the room between Mr. DeMarte and Mr. Witzel's room to use as the "lab," finalizing the bioreactor design, and working on my mid-year presentation (which I will begin during break). Summary of WorkOver the past 15 days, I have made tons of progress working on my Standard of Practice, or SOP. As previously mentioned, the SOP directly outlines the actual in-lab steps I will be carrying out this winter, as well as the materials and methods involved. To write the SOP, I had to source many different papers on hemoglobin synthesis in E. coli, and compare different methods of synthesis to evaluate which ways are the best and most feasible. As you can see in the copy of the SOP below, there are both concrete steps and notes through the document. This fellows project has always been and will always continue to be a learning process, and with every new understanding I gain, there are 10 more ideas to explore. So, even throughout the process of writing the SOP, which is largely concrete, tested scientific lab prodecures, there is still a continuous learning curve which is beneficial to my understanding of the underlying biochemistry (hence, the notes). Copy of SOPBelow is a copy of the SOP in it's current state. I plan to continue to refine and develop the SOP, and I want to have a simplified version of it with very easy to follow, clean step by step instructions. This simplified version will help me craft comprehensive yet relatively digestible proposals when applying for funding. However, until I do that (planned to be done before the end of the week) I wanted to upload the current state of the SOP. Upcoming Plans + Potential OptionsIn the coming weeks, I am planning to do all the preparations I need for the in-lab work. I will apply for funding for the materials, and will order them from reputable sources as soon as I am able. I am also planning to meet with Ms. Carsley on 12/2 to discuss funding and my updated project roadmap. I am still on schedule to begin lab work following winter break.
I am also looking into my options for a PCR thermocyler. I can attempt to purchase one, however they range in the thousands of dollars. A potential venture between the science department in junction with the Fellows funding program could enable me to afford the machine. If not, I am looking into potentially building the machine myself over winter break. However, this could take longer than expected, and the machine likely could be inefficient or inaccurate, which would significantly undermine my research this spring. Which path I will take is TBD. |